Skip to main content

Table 1 Oligonucleotide primer sequences for quantitative PCR assessment of Guinea pig myosin heavy chain mRNA

From: Evidence of changes to skeletal muscle contractile properties during the initiation of disease in the ageing guinea pig model of osteoarthritis

Gene name Forward primer (5'ā€“3') Reverse primer (5'ā€“3') Amplicon size (bp)
MyH1 (MHC IIx) TTCATCCAAATGCAGGAAAG TCTTTATCTCAAAAGTCATAAATACAA 90
MyH2 (MHC IIa) TGTGGAATGACCAGAGCAAG CCTTTGCAATAGGGTAGGACA 85
MyH4 (MHC IIb) TCCATCTACTGCTGCAACG ACTCTGCAGATTTTATTTCCTTG 93
MyH7 (MHC I) AAGTATCGCAAGGCTCAA CCTTTCCTTAATTCCAAGC 129
  1. See Tonge et al. for a comprehensive assessment of primer specificity [36].