Skip to main content

Table 1 Primer sets (5′-3′) used for real-time PCR analysis of gene expression

From: Altered dietary methionine differentially impacts glutathione and methionine metabolism in long-living growth hormone-deficient Ames dwarf and wild-type mice

    Gene of interest GenBank accession #    Forward primer     Reverse primer
Methionine adenosyltransferase 1a (Mat1a) NM_133653 ctgaggcgctctggtgtc tcctgcatgtactgaactgttacc
Glycine N-methyltransferase (Gnmt) NM_010321 gctggacgtagcctgtgg cacgctcatcacgctgaa
S-adenosylhomocysteine hydrolase (Ahcy) NM_016661 ctgttggggttcacttcctg acattcagcttgcccaggt
Cystathionine β-synthase (Cbs) NM_144855 cgcacaggaaggactgcta agccttcacagccacagc
Cystathionase (Cth) NM_145953 gagtctggctgagcttcca cgagggtagctctgtccttc
Betaine homocysteine S-methyltransferase (Bhmt) NM_016668 acgtggacttcctcattgcagagt tgctacgggcttaccagatgcttt
5-Methyltetrahydrofolate-homocysteine methyltransferase (5-MeTHF-hmt) XM_138431 gcagatgtggccagaaaag gccacaaacctcttgactcc
5,10-Methylenetetrahydrofolate reductase (Mthfr) NM_010840 agcttgaagccacctggactgtat agactagcgttgctgggtttcaga
Glutamylcysteine ligase catalytic subunit (Gclc) NM_010295 ggaggcgatgttcttgagac cagagggtcggatggttg
Glutamylcysteine ligase modifier subunit (Gclm) NM_008129 gactcacaatgacccgaaaga gatgctttcttgaagagcttcct
Thioredoxin 1 (Trx1) X77585 cgtggtggacttctctgctacgtggtg ggtcggcatgcatttgacttcacagtc
Thioredoxin 2 (Trx2) U85089 gctagagaagatggtcgccaagcagca tcctcgtccttgatccccacaaacttg
Thioredoxin reductase 1 (TrxR1) AB027565 ggccaacaaaatcggtgaacacatggaag cgccagcaacactgtgttaaattcgccct
Thioredoxin reductase 2 (TrxR2) AB027566 gtcccctcccacatcaaaaaactcccaac ggcccacaggacagtgtcaaaggtgc
Glutaredoxin 1 (Grx1) AB013137 tgcagaaagacccaagaaatcctcagtca tggagattagatcactgcatccgcctatg
Glutaredoxin 2 (Grx2) NM_023505 catcctgctcttactgttccatggccaa tcatcttgtgaagcgcatcttgaaactgg
β2-microglobulin (B2M) NM_00975 atgggaagccgaacatactg cagtctcagtgggggtgaat